algorithms nis elements nikon rrid scr 014329 cellprofiler image analysis software version 4 2 1 cellprofiler rrid scr 007358 prism 10 graphpad (Nikon)
Nikon is a verified supplier 
99
Structured Review
Nikon
algorithms nis elements nikon rrid scr 014329 cellprofiler image analysis software version 4 2 1 cellprofiler rrid scr 007358 prism 10 graphpad
Algorithms Nis Elements Nikon Rrid Scr 014329 Cellprofiler Image Analysis Software Version 4 2 1 Cellprofiler Rrid Scr 007358 Prism 10 Graphpad, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 39764 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+nikon+elements+software+nikon/NIS-Elements/pm40902597-278-75-77
Average 99 stars, based on 39764 article reviews
Algorithms Nis Elements Nikon Rrid Scr 014329 Cellprofiler Image Analysis Software Version 4 2 1 Cellprofiler Rrid Scr 007358 Prism 10 Graphpad, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 39764 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+nikon+elements+software+nikon/NIS-Elements/pm40902597-278-75-77
Average 99 stars, based on 39764 article reviews
algorithms nis elements nikon rrid scr 014329 cellprofiler image analysis software version 4 2 1 cellprofiler rrid scr 007358 prism 10 graphpad - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Recombinant:Article Title: Protocol for measuring labile cytosolic Zn 2+ using an in situ calibration of a genetically encoded FRET sensor. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins Tris(2-pyridylmethyl) amine 98% (TPA) Sigma-Aldrich Cat# 723134 Zinc chloride, anhydrous, 99.95% (metals basis) Alfa Aesar Cat# 87900 Chelex-100, sodium form Sigma-Aldrich Cat# C7901 DMEM/F12, HEPES Thermo Fisher Scientific Cat# 11330057 Horse serum, New Zealand origin Thermo Scientific Cat# 16050122 Hydrocortisone Sigma-Aldrich Cat# H4001 Gibco EGF recombinant human protein Thermo Fisher Scientific Cat# PHG0313 HEPES Sigma-Aldrich Cat# H4034-1KG Calcium chloride, 99.9% Sigma-Aldrich Cat# 449709-10G Potassium chloride Sigma-Aldrich Cat# P9541-500G Magnesium chloride hexahydrate Sigma-Aldrich Cat# 63068-250G Sodium chloride Sigma-Aldrich Cat# S9625-1KG Dextrose (D-glucose) Sigma-Aldrich Cat# D9434-500G Pyrithione MedChem Express Cat# HY-B1747 Saponin Sigma-Aldrich Cat# 47036-50G-F Cholera toxin Sigma-Aldrich Cat# C8052 Potassium hydroxide, ACS reagent >85% Sigma-Aldrich Cat# 221473-25G Pen/Strep Gibco Cat# 15140–122 0.05% Trypsin-EDTA(1X) Gibco Cat# 25300–120 (Continued on next page) 2 STAR Protocols 5, 103130, June 21, 2024 Continued REAGENT or RESOURCE SOURCE IDENTIFIER EGTA, molecular biology grade MilliporeSigma Cat# 324626-25G Strontium chloride, anhydrous, 99.99+% Sigma-Aldrich Cat# 439665-25G Sodium hydroxide pellets Fisher Scientific Cat# S318-500 Experimental models: Cell lines Human: MCF10a + PB-NES ZapCV2 and PB-H2B- mCherry (stable) Lo et al.5 N/A Software and Software:Article Title: Protocol for measuring labile cytosolic Zn 2+ using an in situ calibration of a genetically encoded FRET sensor. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins Tris(2-pyridylmethyl) amine 98% (TPA) Sigma-Aldrich Cat# 723134 Zinc chloride, anhydrous, 99.95% (metals basis) Alfa Aesar Cat# 87900 Chelex-100, sodium form Sigma-Aldrich Cat# C7901 DMEM/F12, HEPES Thermo Fisher Scientific Cat# 11330057 Horse serum, New Zealand origin Thermo Scientific Cat# 16050122 Hydrocortisone Sigma-Aldrich Cat# H4001 Gibco EGF recombinant human protein Thermo Fisher Scientific Cat# PHG0313 HEPES Sigma-Aldrich Cat# H4034-1KG Calcium chloride, 99.9% Sigma-Aldrich Cat# 449709-10G Potassium chloride Sigma-Aldrich Cat# P9541-500G Magnesium chloride hexahydrate Sigma-Aldrich Cat# 63068-250G Sodium chloride Sigma-Aldrich Cat# S9625-1KG Dextrose (D-glucose) Sigma-Aldrich Cat# D9434-500G Pyrithione MedChem Express Cat# HY-B1747 Saponin Sigma-Aldrich Cat# 47036-50G-F Cholera toxin Sigma-Aldrich Cat# C8052 Potassium hydroxide, ACS reagent >85% Sigma-Aldrich Cat# 221473-25G Pen/Strep Gibco Cat# 15140–122 0.05% Trypsin-EDTA(1X) Gibco Cat# 25300–120 (Continued on next page) 2 STAR Protocols 5, 103130, June 21, 2024 Continued REAGENT or RESOURCE SOURCE IDENTIFIER EGTA, molecular biology grade MilliporeSigma Cat# 324626-25G Strontium chloride, anhydrous, 99.99+% Sigma-Aldrich Cat# 439665-25G Sodium hydroxide pellets Fisher Scientific Cat# S318-500 Experimental models: Cell lines Human: MCF10a + PB-NES ZapCV2 and PB-H2B- mCherry (stable) Lo et al.5 N/A Software and Transfection:Article Title: Protocol for measuring labile cytosolic Zn 2+ using an in situ calibration of a genetically encoded FRET sensor. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins Tris(2-pyridylmethyl) amine 98% (TPA) Sigma-Aldrich Cat# 723134 Zinc chloride, anhydrous, 99.95% (metals basis) Alfa Aesar Cat# 87900 Chelex-100, sodium form Sigma-Aldrich Cat# C7901 DMEM/F12, HEPES Thermo Fisher Scientific Cat# 11330057 Horse serum, New Zealand origin Thermo Scientific Cat# 16050122 Hydrocortisone Sigma-Aldrich Cat# H4001 Gibco EGF recombinant human protein Thermo Fisher Scientific Cat# PHG0313 HEPES Sigma-Aldrich Cat# H4034-1KG Calcium chloride, 99.9% Sigma-Aldrich Cat# 449709-10G Potassium chloride Sigma-Aldrich Cat# P9541-500G Magnesium chloride hexahydrate Sigma-Aldrich Cat# 63068-250G Sodium chloride Sigma-Aldrich Cat# S9625-1KG Dextrose (D-glucose) Sigma-Aldrich Cat# D9434-500G Pyrithione MedChem Express Cat# HY-B1747 Saponin Sigma-Aldrich Cat# 47036-50G-F Cholera toxin Sigma-Aldrich Cat# C8052 Potassium hydroxide, ACS reagent >85% Sigma-Aldrich Cat# 221473-25G Pen/Strep Gibco Cat# 15140–122 0.05% Trypsin-EDTA(1X) Gibco Cat# 25300–120 (Continued on next page) 2 STAR Protocols 5, 103130, June 21, 2024 Continued REAGENT or RESOURCE SOURCE IDENTIFIER EGTA, molecular biology grade MilliporeSigma Cat# 324626-25G Strontium chloride, anhydrous, 99.99+% Sigma-Aldrich Cat# 439665-25G Sodium hydroxide pellets Fisher Scientific Cat# S318-500 Experimental models: Cell lines Human: MCF10a + PB-NES ZapCV2 and PB-H2B- mCherry (stable) Lo et al.5 N/A Software and Microscopy:Article Title: Protocol for measuring labile cytosolic Zn 2+ using an in situ calibration of a genetically encoded FRET sensor. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins Tris(2-pyridylmethyl) amine 98% (TPA) Sigma-Aldrich Cat# 723134 Zinc chloride, anhydrous, 99.95% (metals basis) Alfa Aesar Cat# 87900 Chelex-100, sodium form Sigma-Aldrich Cat# C7901 DMEM/F12, HEPES Thermo Fisher Scientific Cat# 11330057 Horse serum, New Zealand origin Thermo Scientific Cat# 16050122 Hydrocortisone Sigma-Aldrich Cat# H4001 Gibco EGF recombinant human protein Thermo Fisher Scientific Cat# PHG0313 HEPES Sigma-Aldrich Cat# H4034-1KG Calcium chloride, 99.9% Sigma-Aldrich Cat# 449709-10G Potassium chloride Sigma-Aldrich Cat# P9541-500G Magnesium chloride hexahydrate Sigma-Aldrich Cat# 63068-250G Sodium chloride Sigma-Aldrich Cat# S9625-1KG Dextrose (D-glucose) Sigma-Aldrich Cat# D9434-500G Pyrithione MedChem Express Cat# HY-B1747 Saponin Sigma-Aldrich Cat# 47036-50G-F Cholera toxin Sigma-Aldrich Cat# C8052 Potassium hydroxide, ACS reagent >85% Sigma-Aldrich Cat# 221473-25G Pen/Strep Gibco Cat# 15140–122 0.05% Trypsin-EDTA(1X) Gibco Cat# 25300–120 (Continued on next page) 2 STAR Protocols 5, 103130, June 21, 2024 Continued REAGENT or RESOURCE SOURCE IDENTIFIER EGTA, molecular biology grade MilliporeSigma Cat# 324626-25G Strontium chloride, anhydrous, 99.99+% Sigma-Aldrich Cat# 439665-25G Sodium hydroxide pellets Fisher Scientific Cat# S318-500 Experimental models: Cell lines Human: MCF10a + PB-NES ZapCV2 and PB-H2B- mCherry (stable) Lo et al.5 N/A Software and other:Article Title: BNP facilitates NMB-encoded histaminergic itch via NPRC-NMBR crosstalk Article Snippet: Sequence- based reagents Nppb primer for RT- PCR: 5’- GTCA GTCG TTTG GGCT GTAAC- 3’, 5’- AGACCCAGGCAGAGTCAGAA- 3’ IDT PCR primers NA Sequence- based reagents Sst primer for RT- PCR: 5’- CCCAGACTCCGTCAGTTTCT –3’, 5’- CAGCAGCTCTGCCAAGAAGT –3’ IDT PCR primers NA Sequence- based reagents Npr1 primer for RT- PCR: 5’- TGGA GACA CAGT CAAC ACAGC- 3’, 5’- CGAA GACA AGTG GATC CTGAG- 3’ IDT PCR primers NA Sequence- based reagents Npr2 primer for RT- PCR: 5’- TGAGCAAGCCACCCACTT- 3’, 5’- AGGGGGCCGCAGATATAC- 3’ IDT PCR primers NA Sequence- based reagents Npr3 primer for RT- PCR: 5’- TGCACACGTCTGCCTACAAT- 3’, 5’- GCACCGCCAACATGATTCTC –3’ IDT PCR primers NA Sequence- based reagents Grpr primer for RT- PCR: 5’- TGAT TCAG AGTG CCTA CAATCTTC- 3’, 5’-TTCCGGGATTCGATCTG- 3’ IDT PCR primers NA Sequence- based reagents Nmbr primer for RT- PCR: 5’- GGGGGTTTCTGTGTTCACTC –3’, 5’- CATGGGGTTCACGATAGCTC –3’ IDT PCR primers NA Sequence- based reagents Actb primer for RT- PCR: 5’- TGTTACCAACTGGGACGACA- 3’, 5’- GGGGTGTTGAAGGTCTCAAA- 3’ IDT PCR primers NA Sequence- based reagents Gapdh primer for RT- PCR: 5’- CCCA GCAA GGAC ACTG AGCAA- 3’, 5’- TTAT GGGG GTCT GGGA TGGAAA- 3’ IDT PCR primers NA Software and algorithms Prism 6 GraphPad Software https://www.graphpad.com/ NA Software and algorithms ImageJ NIH https://imagej.nih.gov/ij NA Software and algorithms |